Validating the Genome Decoder
Today we’ll validate the genome decoder we described yesterday, once again with our friend the yeast Saccharomyces cerevisiae (you may want to enjoy a slice of freshly-baked bread and a stein of Pilsner with this post).
We are aided in this case by the availability of the SacCer3 genome in both 2bit and FASTA formats. We can get the FASTA version in the same place we got the 2bit file:
mkdir /tmp/sacCer3_fasta
cd /tmp/sacCer3_fasta
wget http://hgdownload-test.cse.ucsc.edu/goldenPath/sacCer3/bigZips/\
chromFa.tar.gz
tar xvzf chromFa.tar.gz
There is one FASTA file per sequence, starting something like this:
>chrI
CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACC
CACACACACACATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTG
GCCAACCTGTCTCTCAACTTACCCTCCATTACCCTGCCTCCACTCGTTAC
CCTGTCCCATTCAACCATACCACTCCGAACCACCATCCATCCCTCTACTT
ACTACCACTCACCCACCGTTACCCTCCAATTACCCATATCCAACCCACTG
CCACTTACCCTACCATTACCCTACCATCCACCATGACCTACTCACCATAC
Back in the REPL, we can now spit out our own copy in the same format
(carrying over yeast and other functions and vars from the previous
post).
First we need a new directory for the FASTA files we’ll generate:
(.mkdir (clojure.java.io/file "/tmp/decoded"))Then we convert the keywords in our sequence to strings:
(defn genome-str
"
Convert e.g. [:A :G :T :C] to \"AGTC\"
"
[s]
(->> s
(map name)
(apply str)))A simple function will spit out the files, given a seq:
(defn write-seq
"
Write a (potentially very long) sequence of lines to a text file
"
[filename s]
(with-open [wrt (clojure.java.io/writer filename)]
(doseq [x s]
(.write wrt (str x "\n")))))And now for the actual converter:
(doseq [{:keys [name dna-offset dna-size]} (sequence-headers yeast)]
(let [fname (str "/tmp/decoded/" name ".fa")]
(write-seq fname
(cons (str ">" name)
(->> (genome-sequence yeast dna-offset dna-size)
(partition-all 50)
(map genome-str))))))Did it work?
cd /tmp/sacCer3_fasta
for f in *.fa; do diff $f /tmp/decoded/$f; done
No output – it succeeded! This builds more confidence that we didn’t
screw anything up in the decoder. (There are also a few other
hard-coded unit tests in test_core.clj.)
Comparing file sizes, the FASTA files are about 4 times larger than the original 2bit file. If you tar and compress both versions, the FASTA files are still about 30% larger. It is left as as an exercise to the reader (with some spare hard disk) to do the same comparison with the human genome. (Though larger, the FASTA files would clearly be simpler to work with, and these days 4 GB isn’t too terribly much data; nevertheless, we’ll continue to use the 2bit file and decoder for our explorations.)
Now we are ready to begin playing with the actual data – starting in the next post.
blog comments powered by Disqus